View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1305_high_44 (Length: 372)

Name: NF1305_high_44
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1305_high_44
NF1305_high_44
[»] chr1 (2 HSPs)
chr1 (72-268)||(23029232-23029433)
chr1 (13-43)||(23029435-23029465)


Alignment Details
Target: chr1 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 72 - 268
Target Start/End: Complemental strand, 23029433 - 23029232
Alignment:
Q  72 attaaattgatcgttttcatgt------aaattttcaacgaaatgaatgaacaattcttgagaaaaacaaagaattgagaagccaaaatgacaaaaacta 165  Q
    ||||| ||||||||||||||||      |||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||| ||||||||||    
T  23029433 attaatttgatcgttttcatgtcacccgaaattttcaacgaaatgaatgaacaattcttgagaaaa-caaagtattgaaaagccaaaatcacaaaaacta 23029335  T
Q  166 acactaaaatcacatgaaatgaatgattacggaacgaaaattactaattcaaaagaaacggttgcataaataaaactaggagatataacattagaattta 265  Q
    || |||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||| |||||||||||||  || |||||||||||||||||    
T  23029334 accctaaaatcacatgaaatgaatgattacggaacgaaaattactagatcaaaagaaacggttgtataaataaaactactagctataacattagaattta 23029235  T
Q  266 ccc 268  Q
    |||    
T  23029234 ccc 23029232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 13 - 43
Target Start/End: Complemental strand, 23029465 - 23029435
Alignment:
Q  13 aatattaaggtttgcattatagccacaacta 43  Q
    |||||||||||||||||||||||||||||||    
T  23029465 aatattaaggtttgcattatagccacaacta 23029435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University