View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13056_low_5 (Length: 207)

Name: NF13056_low_5
Description: NF13056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13056_low_5
NF13056_low_5
[»] chr8 (1 HSPs)
chr8 (13-192)||(35073985-35074164)


Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 13 - 192
Target Start/End: Complemental strand, 35074164 - 35073985
Alignment:
Q  13 agcaaaggtgaacaacatttaccacattttacactttgaattttatagctggttgattcaatacaataccattcaaaattcaggaatttcaacaaaaaat 112  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35074164 agcaaaggtgaacaacatttaccacattttacactgtgaattttatagctggttgattcaatacaataccattcaaaattcaggaatttcaacaaaaaat 35074065  T
Q  113 aaatcaatgcaccaagccacagcagaacaaattgggaagacaaattatgcaacaaaaattagtggtgccggagtaactac 192  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35074064 aagtcaatgcaccaagccacagcagaacaaattgggaagacaaattatgcaacaaaaattagtggtgccggagtaactac 35073985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University