View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1304_low_106 (Length: 300)

Name: NF1304_low_106
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1304_low_106
NF1304_low_106
[»] chr4 (1 HSPs)
chr4 (129-214)||(51766739-51766824)


Alignment Details
Target: chr4 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 51766824 - 51766739
Alignment:
Q  129 atcattttaataattgggactgagtcttggcaatgaagcaaatgaaaatactaatgatttggttgagttgttgatatggtcatatg 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51766824 atcattttaataattgggactgagtcttggcaatgaagcaaatgaaaatactaatgatttggttgagttgttgatatggtcatatg 51766739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University