View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1304_high_57 (Length: 383)

Name: NF1304_high_57
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1304_high_57
NF1304_high_57
[»] chr2 (1 HSPs)
chr2 (41-210)||(25293942-25294111)


Alignment Details
Target: chr2 (Bit Score: 166; Significance: 9e-89; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 41 - 210
Target Start/End: Complemental strand, 25294111 - 25293942
Alignment:
Q  41 tgtgcgtggaacaaggttaccgtagaggccgagaatgacgcgaccgagtaaggtggattcggagcatagggtggagatggtgtcgccgagggtgcgattt 140  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25294111 tgtgcgtggaacgaggttaccgtagaggccgagaatgacgcgaccgagtaaggtggattcggagcatagggtggagatggtgtcgccgagggtgcgattt 25294012  T
Q  141 gggaggtaatagttggggcagaggctgaagtccatgaagatgcggtcggtgatggtggggtttggtagct 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25294011 gggaggtaatagttggggcagaggctgaagtccatgaagatgcggtcggtgatggtggggtttggtagct 25293942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University