View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1304_high_137 (Length: 208)

Name: NF1304_high_137
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1304_high_137
NF1304_high_137
[»] chr8 (1 HSPs)
chr8 (99-208)||(39793435-39793544)


Alignment Details
Target: chr8 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 99 - 208
Target Start/End: Original strand, 39793435 - 39793544
Alignment:
Q  99 ccctgcaacaggtttgtttctactttccacaaaaaggggactgagcacaacaaaagataccatcatacgaagtggtaggttgccaagaaaaccctacgat 198  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||    
T  39793435 ccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgccaagaaaaacctacaat 39793534  T
Q  199 taccgccgct 208  Q
    ||||||||||    
T  39793535 taccgccgct 39793544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University