View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1304_high_131 (Length: 215)

Name: NF1304_high_131
Description: NF1304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1304_high_131
NF1304_high_131
[»] chr7 (1 HSPs)
chr7 (1-111)||(28267748-28267858)


Alignment Details
Target: chr7 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 28267858 - 28267748
Alignment:
Q  1 tcatttttggattgcaagaaataatttttattctgctaacaattgcttccagcacagctccacgtggatcattcagcagatggacttcatcaattagtag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  28267858 tcatttttggattgcaagaaataatttttattctgctaacaattgcttccagcgcagctccacgtggatcattcagcagatggacttcatcaattagtag 28267759  T
Q  101 aagtgctatgt 111  Q
    |||||||||||    
T  28267758 aagtgctatgt 28267748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University