View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13049_low_33 (Length: 216)

Name: NF13049_low_33
Description: NF13049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13049_low_33
NF13049_low_33
[»] chr4 (1 HSPs)
chr4 (18-156)||(40799802-40799940)


Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 18 - 156
Target Start/End: Original strand, 40799802 - 40799940
Alignment:
Q  18 tgatgcttcccaaaagtaccacatttacaaccataccagcatctatttacaaccacaatttctttttgagagcatcaactaacgtgtggccaattctcaa 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  40799802 tgatgcttcccaaaagtaccacatttacaaccataccagcatctatttacaaccacaatttctttttgagagcatcaactaatgtgtggccaattctcaa 40799901  T
Q  118 ccacccaagtagcctaaccggtgtcccccacttgatata 156  Q
    |||||||||||||||||||||||||||||||||||||||    
T  40799902 ccacccaagtagcctaaccggtgtcccccacttgatata 40799940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University