View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13043_low_15 (Length: 257)

Name: NF13043_low_15
Description: NF13043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13043_low_15
NF13043_low_15
[»] chr3 (1 HSPs)
chr3 (1-234)||(14996530-14996763)


Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 14996530 - 14996763
Alignment:
Q  1 tgattcacatcatgttgaaactccgctccgttgtcaatgtgcgacatttttagagttcagataatgtttaaccttgaagttcaaaggaacggtttgtgta 100  Q
    ||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||    
T  14996530 tgattcacatcatgtcgaaactccgccccgttgtcaatgtgcgacatttttagagttcagatactgtttaaccttgaagtacaaaggaacggtttgtgta 14996629  T
Q  101 gtgatatttgctaattgtggtggtgtattgtaaagattaagagaaaggaagatatttttatgatttttctattgattggtttcaaggaagaagagggaga 200  Q
    ||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  14996630 gtgatatttgctaattgtggtggggtattgtaaagatgaagagaaaggaagatatttttatgatttttctattgattggtttcaaggaagaggagggaga 14996729  T
Q  201 taaagtatttcattagtatgtagaagaagaaact 234  Q
    ||||||||||||||||||||||| ||||||||||    
T  14996730 taaagtatttcattagtatgtagcagaagaaact 14996763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University