View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13034_low_28 (Length: 216)

Name: NF13034_low_28
Description: NF13034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13034_low_28
NF13034_low_28
[»] chr4 (1 HSPs)
chr4 (1-74)||(10399389-10399466)


Alignment Details
Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 10399466 - 10399389
Alignment:
Q  1 ttgggtgaagcgagagggatatatcattggtaattaccctctagcaaggcta----gctacttatatcattggtattg 74  Q
    |||||||||||||||||||||||||||||||||||||||| | |||||||||    ||||||||||| ||||||||||    
T  10399466 ttgggtgaagcgagagggatatatcattggtaattaccctgtggcaaggctagctagctacttatataattggtattg 10399389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University