View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1302_high_15 (Length: 376)

Name: NF1302_high_15
Description: NF1302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1302_high_15
NF1302_high_15
[»] chr7 (1 HSPs)
chr7 (112-313)||(48250707-48250909)


Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 112 - 313
Target Start/End: Complemental strand, 48250909 - 48250707
Alignment:
Q  112 cgaggaggaagataaggcaaagcagagcagcgagtaacgttggtggttgtcaatagccgatgaggaactaacactgtgcctgcacttgctgcaaccgcca 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48250909 cgaggaggaagataaggcaaagcagagcagcgagtaacgttggtggttgtcaatagccgatgaggaactaacactgtgcctgcacttgctgcaaccgcca 48250810  T
Q  212 ttgtctctcacttttcttcactgttatcctt-ttttcctatgttaagaattaagattcaatgtttttgtttgtttgaggaaaatagagaaaccacccttt 310  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48250809 ttgtctctcacttttcttcactgttatcctttttttcctatgttaagaattaagattcaatgtttttgtttgtttgaggaaaatagagaaaccacccttt 48250710  T
Q  311 gct 313  Q
    |||    
T  48250709 gct 48250707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University