View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13016_low_11 (Length: 244)

Name: NF13016_low_11
Description: NF13016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13016_low_11
NF13016_low_11
[»] chr5 (1 HSPs)
chr5 (25-168)||(23047654-23047796)


Alignment Details
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 25 - 168
Target Start/End: Original strand, 23047654 - 23047796
Alignment:
Q  25 ccttggagtttcgttttgcctcctcggtattgctcaacctgtttcggattatctgcaatcactttgtccaccattttttcaatttcaacaggatctgcta 124  Q
    ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| ||    
T  23047654 ccttggagtttagttttgcctcctcggtattgctcgacctgtttcggattatctgcgatcgctttgtccaccattttttcaatttcaacaggatctgtta 23047753  T
Q  125 tctgtcatttcaaaataataatcaatgaagttgttcagagtgga 168  Q
    ||||||||||  |||||||||||||| |||||| ||||||||||    
T  23047754 tctgtcatttacaaataataatcaataaagttg-tcagagtgga 23047796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University