View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13006_low_59 (Length: 246)

Name: NF13006_low_59
Description: NF13006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13006_low_59
NF13006_low_59
[»] chr8 (3 HSPs)
chr8 (1-92)||(4349269-4349368)
chr8 (134-182)||(4349408-4349456)
chr8 (200-231)||(4349476-4349507)


Alignment Details
Target: chr8 (Bit Score: 67; Significance: 7e-30; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 4349269 - 4349368
Alignment:
Q  1 ttgaaccattaaaataatgtagcactaaataata--------aataaatatctatgcacccacgggttattcaagttctagggttagttgattcaaacac 92  Q
    ||||||||||||||||| ||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4349269 ttgaaccattaaaataaagtagcactaaataatatataaataaataaatatctatgcacccacgggttattcaagttctagggttagttgattcaaacac 4349368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 182
Target Start/End: Original strand, 4349408 - 4349456
Alignment:
Q  134 caccacgttttcctttctatttcttttccctattacattcactcacatg 182  Q
    ||||||||||| ||||||||||| |||||||||||||||||||||||||    
T  4349408 caccacgtttttctttctatttcctttccctattacattcactcacatg 4349456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 200 - 231
Target Start/End: Original strand, 4349476 - 4349507
Alignment:
Q  200 cccatcacccttcctcttcaattcatcccttt 231  Q
    ||||||||||||||||||||||||||||||||    
T  4349476 cccatcacccttcctcttcaattcatcccttt 4349507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University