View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13006_low_44 (Length: 310)

Name: NF13006_low_44
Description: NF13006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13006_low_44
NF13006_low_44
[»] chr6 (1 HSPs)
chr6 (1-159)||(30927760-30927913)


Alignment Details
Target: chr6 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 30927913 - 30927760
Alignment:
Q  1 tgatttaaatgattgactagaaagtaagtaaaggcgggagtcgacccaaatcccaaaatcaaaattaaaacatcgggccccacatcacttccttctctcc 100  Q
    |||||||||||||||||||      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30927913 tgatttaaatgattgacta-----aaagtaaaggcgggagtcgacccaaatcccaaaatcaaaattaaaacatcgggccccacatcacttccttctctcc 30927819  T
Q  101 tctgtcacttaaaactttctgtttggctctctctttctctcttaaccttttcccatttg 159  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30927818 tctgtcacttaaaactttctgtttggctctctctttctctcttaaccttttcccatttg 30927760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University