View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13006_high_65 (Length: 211)

Name: NF13006_high_65
Description: NF13006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13006_high_65
NF13006_high_65
[»] chr4 (1 HSPs)
chr4 (43-192)||(35165506-35165657)


Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 43 - 192
Target Start/End: Complemental strand, 35165657 - 35165506
Alignment:
Q  43 tatccgaaatcaaaagaataaataaggatagaagcaaaactaattcaggctcaaatgaaggcattgccattctcccagagctcccacaaga--gagaaat 140  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||    
T  35165657 tatccgaaatcaaaagaataaataaggatagaagcaaaactaattcaggctcaaatgaaggcattgccattctcccagagctcccacaagagagagaaat 35165558  T
Q  141 atttctagttgaaatatgagaaaacatacaaggaaagaagggatatacagct 192  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  35165557 atttctagttcaaatatgagaaaacatacaaggaaagaagggatatacagct 35165506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University