View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13000_low_38 (Length: 209)

Name: NF13000_low_38
Description: NF13000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13000_low_38
NF13000_low_38
[»] chr7 (1 HSPs)
chr7 (116-195)||(37248913-37248992)


Alignment Details
Target: chr7 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 116 - 195
Target Start/End: Complemental strand, 37248992 - 37248913
Alignment:
Q  116 ccctctgattgcaaacctcagaccggcatgatatggttgttaatttctttgactaaattaaactcatttcaagaggaaac 195  Q
    ||||||||||| |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||    
T  37248992 ccctctgattgaaaacctcagaccggcatgatgtggatgttaatttctttgactaaattaaactcatttcaagaggaaac 37248913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University