View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1299_1D_high_15 (Length: 269)

Name: NF1299_1D_high_15
Description: NF1299_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1299_1D_high_15
NF1299_1D_high_15
[»] chr2 (1 HSPs)
chr2 (23-266)||(10975974-10976217)


Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 23 - 266
Target Start/End: Original strand, 10975974 - 10976217
Alignment:
Q  23 gattcaagctttttgattgattgtttctcacgtttggcgaattgttttgattctctgcatggtgttagaccggagatgtcggcgacagcggggagtggtg 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  10975974 gattcaagctttttgattgattgtttctcacgtttggcgaattgttttgattctctgcatggtgttaggccggagatgtcggcgacagcggggagtggtg 10976073  T
Q  123 atgagatgaggattgatgagagtgctagtgctgctgagaatgcttttagatttgagtttacatcgttgcttggtttttcttggtttgtgctgcagtggat 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  10976074 atgagatgaggattgatgagagtgctagtgctgctgagaatgcttttagatttgagtttacatcgttggttggtttttcttggtttgtgctgcagtggat 10976173  T
Q  223 gatgttggttgagagttttggtttttgaggtagttttggtctta 266  Q
    |||||||||||||||||||||||||||||||| |||||||||||    
T  10976174 gatgttggttgagagttttggtttttgaggtaattttggtctta 10976217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University