View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12999_low_9 (Length: 381)

Name: NF12999_low_9
Description: NF12999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12999_low_9
NF12999_low_9
[»] chr4 (3 HSPs)
chr4 (251-381)||(52987302-52987432)
chr4 (15-106)||(52987090-52987181)
chr4 (145-187)||(52987196-52987238)


Alignment Details
Target: chr4 (Bit Score: 127; Significance: 2e-65; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 251 - 381
Target Start/End: Original strand, 52987302 - 52987432
Alignment:
Q  251 gtatactagtatccacattgccaaagtgacaaggatgccacgtcactaaaactcaccacctcatcgtcaaattggggaaagttttgtgagggaccttgaa 350  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52987302 gtatactagtatccacattggcaaagtgacaaggatgccacgtcactaaaactcaccacctcatcgtcaaattggggaaagttttgtgagggaccttgaa 52987401  T
Q  351 atcaaaaaagaaataaatgtggggtttaaat 381  Q
    |||||||||||||||||||||||||||||||    
T  52987402 atcaaaaaagaaataaatgtggggtttaaat 52987432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 15 - 106
Target Start/End: Original strand, 52987090 - 52987181
Alignment:
Q  15 catagggctaggcaaacaccaattgaaggtgaaaatgatgatttgggaattgaaagcaaaaccctaatttaagattcagaattaacagactt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52987090 catagggctaggcaaacaccaattgaaggtgaaaatgatgatttgggaattgaaagcaaaaccctaatttaagattcagaattaacagactt 52987181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 145 - 187
Target Start/End: Original strand, 52987196 - 52987238
Alignment:
Q  145 atttatataggttttggtgtcaagaaggtgggacccggattct 187  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  52987196 atttatataggttttggtgtcaagaaggtgggacccggattct 52987238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University