View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12991_high_31 (Length: 293)

Name: NF12991_high_31
Description: NF12991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12991_high_31
NF12991_high_31
[»] chr3 (1 HSPs)
chr3 (9-274)||(1457448-1457713)


Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 9 - 274
Target Start/End: Complemental strand, 1457713 - 1457448
Alignment:
Q  9 ataagaaccgaaaacaacgaagggaatgcaaagtttcttgataagaagaaaagtagcaagttattacaatacggggttagccctgatcgtaatggagctt 108  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1457713 ataagaactgaaaacaacgaagggaatgcaaagtttcttgataagaagaaaagtagcaagttattacaatacggggttagccctgatcgtaatggagctt 1457614  T
Q  109 caaagaggaccacattgccttcggcgtgggcgctttcaccgggaaggaaatcccttggctctccgatttggtcagagtcaccgcctaaagcagtcggaag 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1457613 caaagaggaccacattgccttcggcgtgggcgctttcaccgggaaggaaatcccttggctctccgatttggtcagagtcaccgcctaaagcagtcggaag 1457514  T
Q  209 caacggtggcaatggtggtggtagagttggtaatagtgtcaataaagtcttgaattacttcaaaca 274  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1457513 caacggtggcaatggtggtggtagagttggtaatagtgtcaataaagtcttgaattacttcaaaca 1457448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University