View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12985_high_12 (Length: 254)

Name: NF12985_high_12
Description: NF12985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12985_high_12
NF12985_high_12
[»] chr3 (2 HSPs)
chr3 (1-239)||(49993995-49994233)
chr3 (95-160)||(25800028-25800093)
[»] chr1 (1 HSPs)
chr1 (89-156)||(1874599-1874666)


Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 49993995 - 49994233
Alignment:
Q  1 aacaccgtacatggcaccggtgaggaagttatagaagccggtgaaaatcaaagtggtgccaaggttgaggtttttggaaagggtgagcgaaagtactatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  49993995 aacaccgtacatggcaccggtgaggaagttatagaagccggtgaaaatcaaagtggtgccaaggttgaggtttttggaaagggtgagtgaaagtactatt 49994094  T
Q  101 ggtatgtatgtgccaaggtcacccatggctccattgagttcagacaatgttgaatggaaatttaagttgnnnnnnnnnnnnngtatggtggtgagtcttg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||             ||||||||||||||||||    
T  49994095 ggtatgtatgtgccaaggtcacccatggctccattgagttcagataatgttgaatggaaatttaagttgttttttactttttgtatggtggtgagtcttg 49994194  T
Q  201 tgggagtggtggtgggaagagtttgggggtttgatgatg 239  Q
    |||||||||||||||||||||||||||||||||||||||    
T  49994195 tgggagtggtggtgggaagagtttgggggtttgatgatg 49994233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 95 - 160
Target Start/End: Original strand, 25800028 - 25800093
Alignment:
Q  95 actattggtatgtatgtgccaaggtcacccatggctccattgagttcagacaatgttgaatggaaa 160  Q
    ||||| |||||||| |||||||||||||||||||| ||||| | ||||| | || |||||||||||    
T  25800028 actatgggtatgtaggtgccaaggtcacccatggcaccatttaattcagcccattttgaatggaaa 25800093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 89 - 156
Target Start/End: Complemental strand, 1874666 - 1874599
Alignment:
Q  89 gaaagtactattggtatgtatgtgccaaggtcacccatggctccattgagttcagacaatgttgaatg 156  Q
    ||||| |||||||||||||| |||||||||||||||||||| ||||| ||||||| | || |||||||    
T  1874666 gaaagaactattggtatgtaggtgccaaggtcacccatggcaccatttagttcagcccattttgaatg 1874599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University