View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1297_low_81 (Length: 297)

Name: NF1297_low_81
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1297_low_81
NF1297_low_81
[»] chr5 (2 HSPs)
chr5 (30-157)||(22763073-22763201)
chr5 (218-283)||(22762948-22763013)


Alignment Details
Target: chr5 (Bit Score: 82; Significance: 9e-39; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 30 - 157
Target Start/End: Complemental strand, 22763201 - 22763073
Alignment:
Q  30 taatcgagatcgagcaaacacctacatcatgatcgtgcagttgcaggaaaagattattgaggtagtgacataaaacaagaaca-nnnnnnnnngggaaag 128  Q
    |||||||||||| ||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||          |||||||    
T  22763201 taatcgagatcgggcaaacaccaacatcatgatcgtgcaattgcaggaaaagattattgaggtagtgacataaaacaagaacattttttttttgggaaag 22763102  T
Q  129 cataaaacaagaacatgatatcgtgttgt 157  Q
    |||||||||||||||||||||||||||||    
T  22763101 cataaaacaagaacatgatatcgtgttgt 22763073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 218 - 283
Target Start/End: Complemental strand, 22763013 - 22762948
Alignment:
Q  218 tgagattagtggtactacttacatttcttcatcattttgtttgttgctgaaccaacttgtgcattc 283  Q
    |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||    
T  22763013 tgagattagtggtactacttacatttcttcatcattttgtttgttgttaaaccaacttgagcattc 22762948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University