View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1296_low_43 (Length: 251)

Name: NF1296_low_43
Description: NF1296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1296_low_43
NF1296_low_43
[»] chr3 (1 HSPs)
chr3 (29-251)||(52372250-52372472)


Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 29 - 251
Target Start/End: Complemental strand, 52372472 - 52372250
Alignment:
Q  29 aagaataaggactgtgtcacctctttgaagtggaaagaggagttgattggagattatatctacagaggtattgagttgttcataagtgaggtgggtggtg 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52372472 aagaataaggactgtgtcacctctttgaagtggaaagaggagttgattggagattatatctacagaggtattgagttgttcataagtgaggtgggtggtg 52372373  T
Q  129 gaaattgtgtttaagttgtcttcagcccaaatgaaggctggtttggacttgaaggctggtaacctggcccaaactgggaggtattggtcaaccactggtt 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52372372 gaaattgtgtttaagttgtcttcagcccaaatgaaggctggtttggacttgaaggctggtaacctggcccaaactgggaggtattggtcaaccactggtt 52372273  T
Q  229 ggtcgggaaaagacgggtcataa 251  Q
    |||||||||||||||||||||||    
T  52372272 ggtcgggaaaagacgggtcataa 52372250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University