View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1296_low_31 (Length: 317)

Name: NF1296_low_31
Description: NF1296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1296_low_31
NF1296_low_31
[»] chr8 (1 HSPs)
chr8 (99-233)||(36536455-36536589)


Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 99 - 233
Target Start/End: Original strand, 36536455 - 36536589
Alignment:
Q  99 catccaacactcaacaccttcatattcatcagacaaaatccacaaatctaaccattgttccatacttttactttttaaacaagtaatcaatgaaacagaa 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36536455 catccaacactcaacaccttcatattcatcagacaaaatccacaaatctaaccattgttccatacttttactttttaaacaagtaatcaatgaaacagaa 36536554  T
Q  199 tccttataaattacaagtttcttataaacttcatc 233  Q
    |||||||||||||||||||||||||||||||||||    
T  36536555 tccttataaattacaagtttcttataaacttcatc 36536589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University