View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12968_low_47 (Length: 228)

Name: NF12968_low_47
Description: NF12968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12968_low_47
NF12968_low_47
[»] chr1 (1 HSPs)
chr1 (16-59)||(27748786-27748829)


Alignment Details
Target: chr1 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 27748786 - 27748829
Alignment:
Q  16 aaaataattgatagaaaagttagtaaatttatatattgacttct 59  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  27748786 aaaataattgatagaaaagttagtaaatttatatattgacttct 27748829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University