View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12962_high_13 (Length: 250)

Name: NF12962_high_13
Description: NF12962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12962_high_13
NF12962_high_13
[»] chr8 (1 HSPs)
chr8 (1-235)||(40787085-40787319)


Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 40787319 - 40787085
Alignment:
Q  1 cgaccatgtgcctaggtagtctaggcaataattcaacgatcagttataactcaagtattctcccttattgggatatatcatcactttcgggtattattgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40787319 cgaccatgtgcctaggtagtctaggcaataattcaacgatcagttataactcaagtattctcccttattgggatatatcatcactttcgggtattattgt 40787220  T
Q  101 tggtcattcatatgtttaatttcttctagtaataatcttttacacaagaggatgaaccgtattgagtggggttgcatgttcaatctttggcttttggtag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40787219 tggtcattcatatgtttaatttcttctagtaataatcttttacacaagaggatgaaccgtattgagtggggttgcatgttcaatctttggcttttggtag 40787120  T
Q  201 tattgtattttagctatgatttacttgatgataat 235  Q
    ||||||||||||||||| |||||||||||||||||    
T  40787119 tattgtattttagctataatttacttgatgataat 40787085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University