View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1295_low_57 (Length: 244)

Name: NF1295_low_57
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1295_low_57
NF1295_low_57
[»] chr5 (1 HSPs)
chr5 (1-125)||(22044878-22045002)


Alignment Details
Target: chr5 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 22045002 - 22044878
Alignment:
Q  1 atttactatgtatgtaaacttatctaacttataatcattattctacatggtacttttccctattttccatttggttcggtctgtacttctcaaagactta 100  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  22045002 atttactatgtatgtaaacttagctaacttataatcattattctacatagtacttttccctattttccatttggttcggtctgtagttctcaaagactta 22044903  T
Q  101 taatatatacaaattctttagttta 125  Q
    ||||||||||| |||||||||||||    
T  22044902 taatatatacagattctttagttta 22044878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University