View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1295R-Insertion-9 (Length: 169)

Name: NF1295R-Insertion-9
Description: NF1295R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1295R-Insertion-9
NF1295R-Insertion-9
[»] chr1 (2 HSPs)
chr1 (9-81)||(50246552-50246624)
chr1 (124-169)||(50246464-50246509)


Alignment Details
Target: chr1 (Bit Score: 73; Significance: 1e-33; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 9 - 81
Target Start/End: Complemental strand, 50246624 - 50246552
Alignment:
Q  9 tatatttgttcttgggatcccaattggagtcaaattcatacttgtcatcaagatgatcctataccatatagaa 81  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50246624 tatatttgttcttgggatcccaattggagtcaaattcatacttgtcatcaagatgatcctataccatatagaa 50246552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.0000000000009
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 50246509 - 50246464
Alignment:
Q  124 ctcgtggataatgttggtgatatcttataaatttatatttggtttg 169  Q
    |||||||||||||| ||||||||||||||||| |||||||||||||    
T  50246509 ctcgtggataatgtcggtgatatcttataaatctatatttggtttg 50246464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University