View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12946_high_6 (Length: 239)

Name: NF12946_high_6
Description: NF12946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12946_high_6
NF12946_high_6
[»] chr5 (1 HSPs)
chr5 (1-128)||(15926225-15926354)


Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 15926354 - 15926225
Alignment:
Q  1 ctttgcaaatccggtaaacgcttgatgtgaaaaa-atatttcacatcgaattcttttaccgcgatgtgaaaagataagat-tttttccacccttaatagg 98  Q
    |||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  15926354 ctttgcaaatcccgtaaacacttgatgtgaaaaacatatttcacatcgaattcttttaccgcgatgtgaaaagataagatatttttccacccttaatagg 15926255  T
Q  99 ataaccataaccagatataaattttctacc 128  Q
    ||||||||||||||||||||||||||||||    
T  15926254 ataaccataaccagatataaattttctacc 15926225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University