View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12935_low_4 (Length: 505)

Name: NF12935_low_4
Description: NF12935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12935_low_4
NF12935_low_4
[»] chr7 (2 HSPs)
chr7 (270-343)||(30742445-30742518)
chr7 (148-224)||(30742749-30742829)


Alignment Details
Target: chr7 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 270 - 343
Target Start/End: Complemental strand, 30742518 - 30742445
Alignment:
Q  270 attaagttagctaattgaagatgcatcaaaatgacccaaaagataagcatagttttctgcatacaagggaatgc 343  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| || |||| || ||||||    
T  30742518 attaagttagctgattgaagatgcatcaaaatgacccaaaagataagcatagctttttgaatactagtgaatgc 30742445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 148 - 224
Target Start/End: Complemental strand, 30742829 - 30742749
Alignment:
Q  148 attgtttgagttggcagcttattagcatcttta---atcatctcactt-atttggtggtttctttctttcaaaagcatacc 224  Q
    ||||||||||||||||||||| |||||||||||   ||||| |||||| ||||||||| | |||| || ||||||||||||    
T  30742829 attgtttgagttggcagcttaatagcatctttatcgatcatttcacttcatttggtggatgcttttttccaaaagcatacc 30742749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University