View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1291_low_89 (Length: 215)

Name: NF1291_low_89
Description: NF1291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1291_low_89
NF1291_low_89
[»] chr2 (1 HSPs)
chr2 (28-196)||(18021539-18021707)


Alignment Details
Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 28 - 196
Target Start/End: Original strand, 18021539 - 18021707
Alignment:
Q  28 gtgagatgaaacttctcaaa-tttgttgtatcaaaagaatagtagaaaatttgaataaaggtaaaatctttctcaagacaaagatgcccaaacctttcga 126  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18021539 gtgagatgaaacttctcaaaatttgttgtatcaaaagaatagtagaaaatttgaataaaggtaaaatctttctcaagacaaagatgcccaaacctttcga 18021638  T
Q  127 caatcaactttagaggagaggagccggatcnnnnnnnntgggttcgcctactctatgtcatgacattact 196  Q
    ||||||||||||||||||||||||||||||        || |||||||||||||||||||||||||||||    
T  18021639 caatcaactttagaggagaggagccggatc-aaaaaaatgagttcgcctactctatgtcatgacattact 18021707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University