View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12919_high_2 (Length: 309)

Name: NF12919_high_2
Description: NF12919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12919_high_2
NF12919_high_2
[»] chr7 (1 HSPs)
chr7 (92-239)||(5689624-5689776)


Alignment Details
Target: chr7 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 92 - 239
Target Start/End: Original strand, 5689624 - 5689776
Alignment:
Q  92 ttatggtccaaaa-caatgatgacaaccataaggtacttttgcatcannnnnnn-ccttgtcatattcaaacaactactcattccaagcattatgcaaaa 189  Q
    ||||||||||||  ||||||||||||||| | |||||||||||||||        ||||||||||||||||||||||||||| |||||||||||||||||    
T  5689624 ttatggtccaaattcaatgatgacaaccacatggtacttttgcatcattttttttccttgtcatattcaaacaactactcataccaagcattatgcaaaa 5689723  T
Q  190 agaaaaatctccattacaaaatc---catcaaaccacttattatttctccact 239  Q
    |||||||||||||||||||||||   |||||||||||||||||||||||||||    
T  5689724 agaaaaatctccattacaaaatcaatcatcaaaccacttattatttctccact 5689776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University