View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12904_low_15 (Length: 255)

Name: NF12904_low_15
Description: NF12904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12904_low_15
NF12904_low_15
[»] chr7 (1 HSPs)
chr7 (7-240)||(18865661-18865894)


Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 7 - 240
Target Start/End: Original strand, 18865661 - 18865894
Alignment:
Q  7 gcagcacagaccaaatattatcaaggtgaaagtgaattcagatagtgattataacagcggcaacaagttcagaagacttaacgtgcctcttacgctaaag 106  Q
    |||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18865661 gcagcatagaccaaatattatcaagatgaaagtgaattcagatagtgattataacagcggcaacaagttcagaagacttaacgtgcctcttacgctaaag 18865760  T
Q  107 tctagggttgggaagtttctgagcggtgtgatgcaggacgtgatgcgggagcaggacaagcctcaaaagttctaccgtgctatcacggaggagttgaagc 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18865761 tctagggttgggaagtttctgagcggtgtgatgcaggacgtgatgcgggagcaggacaagcctcaaaagttctaccgtgctatcacggaggagttgaagc 18865860  T
Q  207 tcttgaaggattgtagagattctgctcttaaaca 240  Q
    ||||||||||||||||||||||||||||||||||    
T  18865861 tcttgaaggattgtagagattctgctcttaaaca 18865894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University