View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12896_low_8 (Length: 254)

Name: NF12896_low_8
Description: NF12896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12896_low_8
NF12896_low_8
[»] chr4 (1 HSPs)
chr4 (1-239)||(24563420-24563658)


Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 24563420 - 24563658
Alignment:
Q  1 agtttcacatgttgaatctttaccacttcccatggataatgtcaaagactgcaaattactattactagccttctcttgatactcattggtgcatgttgta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  24563420 agtttcacatgttgaatctttaccacttcccatggataatgtcaaagactgcaaattactattactagccttttcttgatactcattggtgcatgttgta 24563519  T
Q  101 accatttggttttgcattggcatgagagtattgttatttgtaaacagataatctgaatcattagattgaatttcgttcggtgtagcaagatctgaatgat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  24563520 accatttggttttgcattggcatgagagtattgttatttgtaaacagataatctgaatcattagattgaatttcgttcggtgtagcaagatctgagtgat 24563619  T
Q  201 tttcagacttgcatacaccgagaaaatccgcaacctttg 239  Q
    |||||||||||||||||||||||||||||||||||||||    
T  24563620 tttcagacttgcatacaccgagaaaatccgcaacctttg 24563658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University