View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12891_low_98 (Length: 224)

Name: NF12891_low_98
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12891_low_98
NF12891_low_98
[»] scaffold0606 (1 HSPs)
scaffold0606 (1-217)||(4191-4416)


Alignment Details
Target: scaffold0606 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: scaffold0606
Description:

Target: scaffold0606; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 4191 - 4416
Alignment:
Q  1 tattgtactctctacaagtacacatgtgctgcgagatagttttttatgttgaaattattaaaattttatttgcaatctactaagtcttttgatagattaa 100  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4191 tattgtactctttacaagtacacatgtgctgcgagatagttttttatgttgaaattattaaaattttatttgcaatctactaagtcttttgatagattaa 4290  T
Q  101 gtagccatgctttgatttttattaaaatattttgttcactagtagggtatgatttcctccaactgtatt-aattaacaccagatctcggat--------c 191  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||||        |    
T  4291 gtagccatactttgatttttattaaaatattttgttcactagtagggtatcatttcctccaactgtattaaattaacaccagatatcggatcccaaacac 4390  T
Q  192 ccgaacccgattgaaccttcttctca 217  Q
    ||||||||||||||||||||||||||    
T  4391 ccgaacccgattgaaccttcttctca 4416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University