View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1289-Insertion-4 (Length: 325)

Name: NF1289-Insertion-4
Description: NF1289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1289-Insertion-4
NF1289-Insertion-4
[»] chr1 (2 HSPs)
chr1 (165-325)||(8407519-8407679)
chr1 (4-33)||(8407822-8407851)


Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 165 - 325
Target Start/End: Complemental strand, 8407679 - 8407519
Alignment:
Q  165 tgtctcaaatcaaacttgttcttaatttctaaaactgccggagactgaacttacagcatccattagctgctttatttcagattcactaagcttggatccc 264  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8407679 tgtctcaaatcaaacttgttcttaatttctaaaactgccggagactgaacttacagcatccattagctgctttatttcagattcactaagcttggatccc 8407580  T
Q  265 aatttggacagtccagattttagttcttcatatgtgattgtgccacttcgatcagtatcta 325  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  8407579 aatttggacagtccagattttagttcttcatatgtgattgtgccacttcgatcggtatcta 8407519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 4 - 33
Target Start/End: Complemental strand, 8407851 - 8407822
Alignment:
Q  4 aacactagtgtctgtttgatgtgagaaaat 33  Q
    ||||||||||||||||||||||||||||||    
T  8407851 aacactagtgtctgtttgatgtgagaaaat 8407822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University