View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12884_low_17 (Length: 285)

Name: NF12884_low_17
Description: NF12884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12884_low_17
NF12884_low_17
[»] chr2 (1 HSPs)
chr2 (7-269)||(13116571-13116836)


Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 7 - 269
Target Start/End: Complemental strand, 13116836 - 13116571
Alignment:
Q  7 cgttggagaaagtgtcgggaggtggcttttggcgacgaacaacggcattggaaccattgcggttgcgtcgtcgtggttgtcgaggttgtggttcttccac 106  Q
    |||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13116836 cgttggagaaagtgtcgggaggtggcttttggcgacgagcaacggcactggaaccattgcggttgcgtcgtcgtggttgtcgaggttgtggttcttccac 13116737  T
Q  107 atgatcctcatcaaggatgcgcagcaattgcatcaatgatgccattgttagcaagctagcttggaagagctaaagttttagatgcctt-gtaggagatgt 205  Q
    ||||||||||||||||| |  ||||||||||||||||||||||||||||| | || ||||||||||| ||| |||||||||||||||| |||||||||||    
T  13116736 atgatcctcatcaaggaggttcagcaattgcatcaatgatgccattgttaactagttagcttggaagggctcaagttttagatgccttggtaggagatgt 13116637  T
Q  206 tgcacccatctatatataga--atatgtatatgacttgcttaaggaataatatgtaggaccctgtt 269  Q
    ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||    
T  13116636 tgcacccatctatatatagaatatatgtatatgacttgcttaaggaataatatgtaggaccctgtt 13116571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University