View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12880_low_5 (Length: 281)

Name: NF12880_low_5
Description: NF12880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12880_low_5
NF12880_low_5
[»] chr1 (1 HSPs)
chr1 (17-266)||(4554947-4555196)


Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 17 - 266
Target Start/End: Original strand, 4554947 - 4555196
Alignment:
Q  17 aaatttgatttttagtctcaaatttattgtttgattcatttttgcgtgaatttatatgaacataagtaaataattttacactcaattcatttttaatcaa 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||    
T  4554947 aaatttgatttttagtctcaaatttattgtttgattcatttttgcgtgaatttatttgaacataagtaaataattttacactcaactcatttttaatcaa 4555046  T
Q  117 aatactttcgtcaaaatcaatttttgcccctgcaaaacaaaacacactaattagtaattactacatgttttcttattgccaaatcactaatactactcta 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4555047 aatactttcgtcaaaatcaatttttgcccctgcaaaacaaaacacactaattagtaattactacatgttttcttattgccaaatcactaatactactcta 4555146  T
Q  217 tgaatcttcatataaatatgtaatcagatggctcccagttacaattcagt 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4555147 tgaatcttcatataaatatgtaatcagatggctcccagttacaattcagt 4555196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University