View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12879_high_38 (Length: 214)

Name: NF12879_high_38
Description: NF12879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12879_high_38
NF12879_high_38
[»] chr4 (1 HSPs)
chr4 (15-196)||(43514042-43514223)


Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 196
Target Start/End: Original strand, 43514042 - 43514223
Alignment:
Q  15 cacagacatacgtggttaaattcaataatatcatttctacatagatcaatatgtcactgttgtggctgatgaacgtgtcattgattgatgaattaagagt 114  Q
    |||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  43514042 cacaaacatacatggttaaattcaataatatcatttctacatagatcaatatgtcactgttgtgtctgatgaacgtgtcattgattgatgaattaagagt 43514141  T
Q  115 gcttaaattgaaagtttggtgggatgataaacaaacctgagaaagaaatgggtggagggagagcgaggactcgggtgtggcc 196  Q
    ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43514142 gcttaaattgaaagtttggtgagatgagaaacaaacctgagaaagaaatgggtggagggagagcgaggactcgggtgtggcc 43514223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University