View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12876_low_4 (Length: 288)

Name: NF12876_low_4
Description: NF12876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12876_low_4
NF12876_low_4
[»] chr4 (1 HSPs)
chr4 (8-288)||(28265163-28265442)


Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 8 - 288
Target Start/End: Original strand, 28265163 - 28265442
Alignment:
Q  8 gagaagcagagagcataacgaggagaggcaaagcagtcgaaatagagagagggacaggggaagagatcgagacagggattatggacgagaacgggaccga 107  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28265163 gagaaacagagagcataacgaggagaggcaaagcagtcgaaatagagagagggacaggggaagagatcgagacagggattatggacgagaacgggaccga 28265262  T
Q  108 agtagacaccgatattaaaaatagcagtagaagtgcattctgatgtcttgactatatggttatgtgtaaccttttttgcgaaggatttcaattgctttga 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||    
T  28265263 agtagacaccgatattaaaaatagcagtagaagtgcattctgatgtcttgactatatagttatgtgtaacc-tttttgggaaggatttcaattgctttga 28265361  T
Q  208 attaaatccttaaattggggattgatatcctgcaatgcgatgaatgcatggaccatttgtataacctaagatatttgtgtt 288  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28265362 attaaatccttaaattggggattgatatcctgcaatgcgatgaatgcatggaccatttgtataacctaagatatttgtgtt 28265442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University