View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12874_low_3 (Length: 255)

Name: NF12874_low_3
Description: NF12874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12874_low_3
NF12874_low_3
[»] chr7 (1 HSPs)
chr7 (16-246)||(30337257-30337487)


Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 30337257 - 30337487
Alignment:
Q  16 caagttgcatatatttatagaaaattgctcacaccctttcatggatacttgcatcaatttacatgaacacttgcatactttcacacgagttatcataaat 115  Q
    |||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||||    
T  30337257 caagttacatatatttatagaaaattgctcacatcctttcatggatacttgcatcaatttacatgaacacttgcatcctttcacaggagtcatcataaat 30337356  T
Q  116 taactataataattaagttattcttacatgacagtccaaatagccatttgcatatttaattatgtctttgaattttctttcnnnnnnnngaatatgtctt 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |  |||||||    
T  30337357 taactataataattaagttattcttacatgacagtccaaatagccatttgcatatttaattatgtctttgaattttctttcaaaaaaaaaatcatgtctt 30337456  T
Q  216 tgaatttcaaggatctttatcatattcatct 246  Q
    ||||||||||||||||||||| |||||||||    
T  30337457 tgaatttcaaggatctttatcgtattcatct 30337487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University