View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1285-Insertion-10 (Length: 362)

Name: NF1285-Insertion-10
Description: NF1285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1285-Insertion-10
NF1285-Insertion-10
[»] chr4 (1 HSPs)
chr4 (239-362)||(56474013-56474136)


Alignment Details
Target: chr4 (Bit Score: 84; Significance: 7e-40; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 239 - 362
Target Start/End: Original strand, 56474013 - 56474136
Alignment:
Q  239 gttatgtgcttgtttatgatgttggttttggttagaagagaatgagtttgattgttgatgttggttttcaactctctagccccttaatttgaaattgggt 338  Q
    |||| |||||||||| ||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| ||||| ||||||||||||  ||| |    
T  56474013 gttaggtgcttgtttgtgatgttggttttggttagaagagaataaatttgattgttgatgttggttttcaactccctagcaccttaatttgaatgtggat 56474112  T
Q  339 gtttgtttgagttttttctattga 362  Q
    ||||||||||||||||| ||||||    
T  56474113 gtttgtttgagttttttttattga 56474136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University