View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12846_low_8 (Length: 256)

Name: NF12846_low_8
Description: NF12846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12846_low_8
NF12846_low_8
[»] chr8 (1 HSPs)
chr8 (7-242)||(39994384-39994619)


Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 7 - 242
Target Start/End: Original strand, 39994384 - 39994619
Alignment:
Q  7 ttcacaacgtaaaacaaaccaatcttatcactcagagtatcagatttgcgcgaagacaaagacgaattcgaaatggcgtagaaattagcgagttgaagta 106  Q
    |||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39994384 ttcacaacgtaacacaaaccgatcttatcactgagagtatcagatttgcgcgaagacaaagacgaattcgaaatggcgtagaaattagcgagttgaagta 39994483  T
Q  107 gcgactgaaatgaaaacacgaagaaacaacgagaaatcgacgatcgattaggaatgatgaaattgtccggtgcttcaatgaatagagattgagatttagg 206  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  39994484 gcgactgaattgaaaacacgaagaaacaacgagaaatcgacgatcgattaggaatgatgaaattgtgcggtgcttcaatgaatagagattgagatttagg 39994583  T
Q  207 gatgaagctgtgtgtacctgctttaggtctcctagc 242  Q
    ||||||||||||||||||||||||||||||||||||    
T  39994584 gatgaagctgtgtgtacctgctttaggtctcctagc 39994619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University