View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12846_high_7 (Length: 260)

Name: NF12846_high_7
Description: NF12846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12846_high_7
NF12846_high_7
[»] chr5 (2 HSPs)
chr5 (119-253)||(42801847-42801982)
chr5 (18-120)||(42801718-42801820)


Alignment Details
Target: chr5 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 119 - 253
Target Start/End: Original strand, 42801847 - 42801982
Alignment:
Q  119 caatacttaatgatatcgttttgctagacaatcatgaggaaatttttcgcatttcgannnnnnnn-actagtttataacatatttttataagatacttca 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||| ||||| ||||||||||||    
T  42801847 caatacttaatgatatcgttttgctagacaatcatgaggaaatttttcgcatttcgatttttttttactagtttataacatttttttttaagatacttca 42801946  T
Q  218 actaccgttttaatttataactcagatttcttctca 253  Q
    |||||||||| |||||||||||||||||||||||||    
T  42801947 actaccgtttgaatttataactcagatttcttctca 42801982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 18 - 120
Target Start/End: Original strand, 42801718 - 42801820
Alignment:
Q  18 aaaattacatatgacatagaatgtatctaacgaaatccgacatcagggtcattgcaaaataacacacgtccaaatttcataacaaacgagataaaagatt 117  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||    
T  42801718 aaaattacatatgacatagaatgtatctaacgaaatccgaaatcagggtcattgcaaaattacacacgtccaaatttcataacaaacgaaataaaagatt 42801817  T
Q  118 gca 120  Q
    |||    
T  42801818 gca 42801820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University