View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12843_low_11 (Length: 258)

Name: NF12843_low_11
Description: NF12843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12843_low_11
NF12843_low_11
[»] chr8 (1 HSPs)
chr8 (1-248)||(28829768-28830015)


Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 28829768 - 28830015
Alignment:
Q  1 aaaaatggtctgatcctatctctggtactttgccgttgacaagcaagattggagcggggctgctagccggtgggattggcgcggctgtcgggaatccggc 100  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28829768 aaaaatggtctgatcctatctccggtactttgccgttgacaagcaagattggagcggggctgctagccggtgggattggcgcggctgtcgggaatccggc 28829867  T
Q  101 tgatgtggcaatggttaggatgcaggccgatggaagacttccatcggcccaaagaagaaactataaatctgtggtcaacgccatctccaggatggcgaaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||    
T  28829868 tgatgtggcaatggttaggatgcaggccgatggaagacttccatcggcccaaagaagaaactataaatctgtcgtcgacgccatctccaggatggcgaaa 28829967  T
Q  201 gacgagggagttactagcctatggcgcggttcatctctaacagtgaac 248  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||    
T  28829968 gacgagggagttactagcctatggcgcggttcatctctgacagtgaac 28830015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University