View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12842_high_23 (Length: 203)

Name: NF12842_high_23
Description: NF12842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12842_high_23
NF12842_high_23
[»] chr5 (1 HSPs)
chr5 (15-183)||(35612522-35612691)


Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 15 - 183
Target Start/End: Original strand, 35612522 - 35612691
Alignment:
Q  15 caaagggagctaccataaatactcatgtacattgaattcgaagag-acctaagcattacatcaaatcatatttaacacaatagatacaatcatacaacca 113  Q
    ||||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  35612522 caaagggagctaccataaatactcatgtacactgaatttgaagaggacctaagcattacatcaaatcatatttaacacaatagattcaatcatacaacca 35612621  T
Q  114 tattacaaacattgcccctgaatcatggtgcatgcatgcatcaccccaatcatcggttgggaagtgggga 183  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||    
T  35612622 tattacaaacattgcccctgaatcatggtgcatgcatgcatcaccccaatcatcggctgagaagtgggga 35612691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University