View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12841_low_57 (Length: 222)

Name: NF12841_low_57
Description: NF12841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12841_low_57
NF12841_low_57
[»] chr7 (1 HSPs)
chr7 (73-205)||(10188286-10188417)


Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 73 - 205
Target Start/End: Original strand, 10188286 - 10188417
Alignment:
Q  73 gtattgaaatatttttcttgaaaaattattcatcccacaaattaaggtgacaatgactaaatgaagctaattttagaaaaagtcataaccatcaacaaaa 172  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10188286 gtattgaaatatttttcttgaaaaattattcatcacacaaattaaggtgacaatgactaaatgaagctaattttagaaaaagtcataaccatcaacaaaa 10188385  T
Q  173 agtgccacttctaactctaacacctaagaaatt 205  Q
    |||||||||||||||||| ||||||||||||||    
T  10188386 agtgccacttctaactct-acacctaagaaatt 10188417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University