View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12841_high_20 (Length: 418)

Name: NF12841_high_20
Description: NF12841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12841_high_20
NF12841_high_20
[»] chr1 (2 HSPs)
chr1 (1-206)||(41592362-41592567)
chr1 (250-404)||(41592167-41592321)


Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 41592567 - 41592362
Alignment:
Q  1 ttttccttcatcaaacatgcattacctgagatagcaaatgaatcaccagtgctggctccactgttttgcttctctacaagtacactgctttcaatacagc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41592567 ttttccttcatcaaacatgcattacctgagatagcaaatgaatcaccagtgctggctccactgttttgcttctctacaagtacactgctttcaatacagc 41592468  T
Q  101 tgtttggcattacttcagtatgtgattgaacccccnnnnnnnnnnnnnnncttactttctgtgaatcatctttaggctttctttggctggaagatcctct 200  Q
    ||||||||||||||||| |||||||||||||||||               ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41592467 tgtttggcattacttcattatgtgattgaaccccctttttttcattttttcttactttctgtgaatcatctttaggctttctttggctggaagatcctct 41592368  T
Q  201 gcgaac 206  Q
    ||||||    
T  41592367 gcgaac 41592362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 250 - 404
Target Start/End: Complemental strand, 41592321 - 41592167
Alignment:
Q  250 aacaaacctgtggcaagagttgcacctttgaagtttccatccacttgtgaaatctcttggcacaaggaagtaccatgtggatttttggccgagttatgtt 349  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||    
T  41592321 aacaaacctgtggcaagagttgcacctttgaagtttccatccacttgtgaaatctcttggcacaaggtagtaccaagtggatttttggccgagttatgtt 41592222  T
Q  350 ggttcttggtgcttttggaatactttctcttggaaccctttgcttcagtggaatt 404  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41592221 ggttcttggtgcttttggaatactttctcttggaaccctttgcttcagtggaatt 41592167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University