View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12826_low_16 (Length: 241)

Name: NF12826_low_16
Description: NF12826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12826_low_16
NF12826_low_16
[»] chr4 (2 HSPs)
chr4 (66-143)||(44959017-44959094)
chr4 (165-241)||(44958935-44959001)
[»] chr7 (1 HSPs)
chr7 (201-239)||(31846128-31846166)


Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 66 - 143
Target Start/End: Complemental strand, 44959094 - 44959017
Alignment:
Q  66 catctctctttctgggccacaacaaagctcgtgcggtaaaaggaatgaaacagtgtgttaccctaagactatactata 143  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44959094 catctctctttctgggccacaacaaagctcgtgcggtaaaaggaatgaaacagtgtgttaccctaagactatactata 44959017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 165 - 241
Target Start/End: Complemental strand, 44959001 - 44958935
Alignment:
Q  165 tgtactagaactactattagtaagtgaagtgaagtgaagtgaagtgtgttaaataatgtaaatttacattgcttttt 241  Q
    ||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||    
T  44959001 tgtactagaactactattagtaagtgaagtgaagtg----------tgttaaataatgtaaatttacattgcttttt 44958935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 201 - 239
Target Start/End: Original strand, 31846128 - 31846166
Alignment:
Q  201 aagtgaagtgtgttaaataatgtaaatttacattgcttt 239  Q
    ||||||| |||||||||||||||||||||||||||||||    
T  31846128 aagtgaaatgtgttaaataatgtaaatttacattgcttt 31846166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University