View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12820_low_61 (Length: 233)

Name: NF12820_low_61
Description: NF12820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12820_low_61
NF12820_low_61
[»] chr8 (1 HSPs)
chr8 (20-217)||(31455257-31455454)


Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 217
Target Start/End: Original strand, 31455257 - 31455454
Alignment:
Q  20 catatatgagtatgattgctttagaaagaaggcaaagaaggaaatttctaagcaacttagtgaaatgaagaaaatggaaaacaaagtaaagcttttttct 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  31455257 catatatgagtatgattgctttagaaagaaggcaaagaaggaaatttcaaagcaacttggtgaaatgaagaaaatggaaaacaaagtaaagcttttttct 31455356  T
Q  120 attatgggacaagatcaaaatttaatatttttggctaaggttttaagagaagctaccaccatcacaatatctatatttcgttctcttttactattcat 217  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31455357 attatgggccaagatcaaaatttaatatttttggctaaggttttaagagaagctaccaccatcacaatatctatatttcgttctcttttactattcat 31455454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University