View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12820_high_64 (Length: 214)

Name: NF12820_high_64
Description: NF12820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12820_high_64
NF12820_high_64
[»] chr3 (1 HSPs)
chr3 (15-179)||(48751068-48751232)


Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 15 - 179
Target Start/End: Complemental strand, 48751232 - 48751068
Alignment:
Q  15 gagacaaaagctgccttggtatgtgattgatgctatcctcgccattccctctcatagaattgatcagcgagatttaattgcctggaaaggaaaaattatg 114  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  48751232 gagaaaaaagctgccttggtatgtgattgatgctatcctcgccattccctctcatagaattgatcaacgagatttaattgcctggaaaggaaaaattatg 48751133  T
Q  115 ggaatttctagcctacgcgtctctattacgagtgagcagtttgataaataattcagttactgcta 179  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48751132 ggaatttctagcctacgcgtctctattacgagtgagcagtttgataaataattcagttactgcta 48751068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University