View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1281_low_45 (Length: 306)

Name: NF1281_low_45
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1281_low_45
NF1281_low_45
[»] chr3 (1 HSPs)
chr3 (90-210)||(3598359-3598479)


Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 90 - 210
Target Start/End: Original strand, 3598359 - 3598479
Alignment:
Q  90 ctgtaaatgttgcaaaagaccaagcagttggtgcagaaaaccccgtaaatgacactttaggtggttcggatgttttagtgagtgataaagcacatgctgc 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  3598359 ctgtaaatgttgcaaaagaccaagcagttggtgcagaaaaccccgtaaatgacactttaggtggttcggatgttttagtgaatgataaagcacatgctgc 3598458  T
Q  190 cgaaaattctataaatgatac 210  Q
    |||||||||||||||||||||    
T  3598459 cgaaaattctataaatgatac 3598479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University